shRNA:Article Title: Mechanobiological mechanism of cyclic stretch-induced cell columnarization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermo Fisher Cat#H3569 Critical commercial assays xCELLigence E-plates Aglient Cat#300601010 Experimental models: Cell lines Canine: MDCK (NBL-2) cell ATCC CatCCL-34 Canine: MK4 cell HH Lin et al.68 N/A Human: H184B5F5/M10 cell BCRC Cat#60197 Human: IEC-18 cell ATCC Cat#CRL-1589 Human: 293FT cell Thermo Fisher Cat#R70007 Oligonucleotides shRNA target sequence: shTJP1#1 GCAATAAAGCAGCGTTTCTAT RNAi core TRCN0000116252 shRNA target sequence: TJP1#2 CGCCGCATTGTAGAATCAGAT RNAi core TRCN0000091620 siRNA target sequence: siVCL#1 sense CCAACAUUCAGCCACAGAU antisense AUCUGUGGCUGAAUGUUGG This paper N/A siRNA target sequence: siVCL#2 sense CGGAUUAGAACCAACCUCU antisense AGAGGUUCUAAUCCG This paper N/A Recombinant DNA pSVlacOras HH Yeh et al.69 N/A Software and algorithms MATLAB Mathworks https://www.mathworks.com/products/ matlab.html ImageJ Schneider et al.70 https://imagej.nih.gov/ij/ GraphPad Prism 9 GraphPad Software https://www.graphpad.com/ Deposited data Rigidity heatmap algorithm This paper https://github.com/lunweilee/rigidity- heatmap.git Other Dulbecco’s modified Eagle’s medium (DMEM) Sigma‒Aldrich Cat#12800–017 calf serum Thermo Fisher Cat#SH30087.03 Minimum Essential Medium α Thermo Fisher Cat#11900024 fetal bovine serum Thermo Fisher Cat#10437028 polydimethylsiloxane membrane (PDMS) TAIHOYA Corp. Cat#PM22-Collagen type I Fish collagen homemade N/A ATMS dynamic culture system TAIHOYA Corp. Cat#Tansfomer X Cell Reports 44, 115662, May 27, 2025 19 epithelial cell line IEC-18 was generously provided by Dr. Wen-Tai Chiu from National Cheng Kung University in Taiwan and maintained in DMEM supplemented with 5% FBS. .. MDCK cells were pretreated with 10 μM PF573228 (PF228) (Selleckchem, Houston, TX, USA) for 30 min before undergoing cyclic stretch experiments, during which the cells were continuously exposed to 10 μM PF228 for 24 h. Cell contractility was inhibited by treatment with 50 μM blebbistatin (BB) (Tocris Bioscience, Bristol, UK) for 30 min before and during 24 h of cyclic stretching.
Sequencing:Article Title: Mechanobiological mechanism of cyclic stretch-induced cell columnarization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermo Fisher Cat#H3569 Critical commercial assays xCELLigence E-plates Aglient Cat#300601010 Experimental models: Cell lines Canine: MDCK (NBL-2) cell ATCC CatCCL-34 Canine: MK4 cell HH Lin et al.68 N/A Human: H184B5F5/M10 cell BCRC Cat#60197 Human: IEC-18 cell ATCC Cat#CRL-1589 Human: 293FT cell Thermo Fisher Cat#R70007 Oligonucleotides shRNA target sequence: shTJP1#1 GCAATAAAGCAGCGTTTCTAT RNAi core TRCN0000116252 shRNA target sequence: TJP1#2 CGCCGCATTGTAGAATCAGAT RNAi core TRCN0000091620 siRNA target sequence: siVCL#1 sense CCAACAUUCAGCCACAGAU antisense AUCUGUGGCUGAAUGUUGG This paper N/A siRNA target sequence: siVCL#2 sense CGGAUUAGAACCAACCUCU antisense AGAGGUUCUAAUCCG This paper N/A Recombinant DNA pSVlacOras HH Yeh et al.69 N/A Software and algorithms MATLAB Mathworks https://www.mathworks.com/products/ matlab.html ImageJ Schneider et al.70 https://imagej.nih.gov/ij/ GraphPad Prism 9 GraphPad Software https://www.graphpad.com/ Deposited data Rigidity heatmap algorithm This paper https://github.com/lunweilee/rigidity- heatmap.git Other Dulbecco’s modified Eagle’s medium (DMEM) Sigma‒Aldrich Cat#12800–017 calf serum Thermo Fisher Cat#SH30087.03 Minimum Essential Medium α Thermo Fisher Cat#11900024 fetal bovine serum Thermo Fisher Cat#10437028 polydimethylsiloxane membrane (PDMS) TAIHOYA Corp. Cat#PM22-Collagen type I Fish collagen homemade N/A ATMS dynamic culture system TAIHOYA Corp. Cat#Tansfomer X Cell Reports 44, 115662, May 27, 2025 19 epithelial cell line IEC-18 was generously provided by Dr. Wen-Tai Chiu from National Cheng Kung University in Taiwan and maintained in DMEM supplemented with 5% FBS. .. MDCK cells were pretreated with 10 μM PF573228 (PF228) (Selleckchem, Houston, TX, USA) for 30 min before undergoing cyclic stretch experiments, during which the cells were continuously exposed to 10 μM PF228 for 24 h. Cell contractility was inhibited by treatment with 50 μM blebbistatin (BB) (Tocris Bioscience, Bristol, UK) for 30 min before and during 24 h of cyclic stretching.
Recombinant:Article Title: Mechanobiological mechanism of cyclic stretch-induced cell columnarization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermo Fisher Cat#H3569 Critical commercial assays xCELLigence E-plates Aglient Cat#300601010 Experimental models: Cell lines Canine: MDCK (NBL-2) cell ATCC CatCCL-34 Canine: MK4 cell HH Lin et al.68 N/A Human: H184B5F5/M10 cell BCRC Cat#60197 Human: IEC-18 cell ATCC Cat#CRL-1589 Human: 293FT cell Thermo Fisher Cat#R70007 Oligonucleotides shRNA target sequence: shTJP1#1 GCAATAAAGCAGCGTTTCTAT RNAi core TRCN0000116252 shRNA target sequence: TJP1#2 CGCCGCATTGTAGAATCAGAT RNAi core TRCN0000091620 siRNA target sequence: siVCL#1 sense CCAACAUUCAGCCACAGAU antisense AUCUGUGGCUGAAUGUUGG This paper N/A siRNA target sequence: siVCL#2 sense CGGAUUAGAACCAACCUCU antisense AGAGGUUCUAAUCCG This paper N/A Recombinant DNA pSVlacOras HH Yeh et al.69 N/A Software and algorithms MATLAB Mathworks https://www.mathworks.com/products/ matlab.html ImageJ Schneider et al.70 https://imagej.nih.gov/ij/ GraphPad Prism 9 GraphPad Software https://www.graphpad.com/ Deposited data Rigidity heatmap algorithm This paper https://github.com/lunweilee/rigidity- heatmap.git Other Dulbecco’s modified Eagle’s medium (DMEM) Sigma‒Aldrich Cat#12800–017 calf serum Thermo Fisher Cat#SH30087.03 Minimum Essential Medium α Thermo Fisher Cat#11900024 fetal bovine serum Thermo Fisher Cat#10437028 polydimethylsiloxane membrane (PDMS) TAIHOYA Corp. Cat#PM22-Collagen type I Fish collagen homemade N/A ATMS dynamic culture system TAIHOYA Corp. Cat#Tansfomer X Cell Reports 44, 115662, May 27, 2025 19 epithelial cell line IEC-18 was generously provided by Dr. Wen-Tai Chiu from National Cheng Kung University in Taiwan and maintained in DMEM supplemented with 5% FBS. .. MDCK cells were pretreated with 10 μM PF573228 (PF228) (Selleckchem, Houston, TX, USA) for 30 min before undergoing cyclic stretch experiments, during which the cells were continuously exposed to 10 μM PF228 for 24 h. Cell contractility was inhibited by treatment with 50 μM blebbistatin (BB) (Tocris Bioscience, Bristol, UK) for 30 min before and during 24 h of cyclic stretching.
Software:Article Title: Mechanobiological mechanism of cyclic stretch-induced cell columnarization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermo Fisher Cat#H3569 Critical commercial assays xCELLigence E-plates Aglient Cat#300601010 Experimental models: Cell lines Canine: MDCK (NBL-2) cell ATCC CatCCL-34 Canine: MK4 cell HH Lin et al.68 N/A Human: H184B5F5/M10 cell BCRC Cat#60197 Human: IEC-18 cell ATCC Cat#CRL-1589 Human: 293FT cell Thermo Fisher Cat#R70007 Oligonucleotides shRNA target sequence: shTJP1#1 GCAATAAAGCAGCGTTTCTAT RNAi core TRCN0000116252 shRNA target sequence: TJP1#2 CGCCGCATTGTAGAATCAGAT RNAi core TRCN0000091620 siRNA target sequence: siVCL#1 sense CCAACAUUCAGCCACAGAU antisense AUCUGUGGCUGAAUGUUGG This paper N/A siRNA target sequence: siVCL#2 sense CGGAUUAGAACCAACCUCU antisense AGAGGUUCUAAUCCG This paper N/A Recombinant DNA pSVlacOras HH Yeh et al.69 N/A Software and algorithms MATLAB Mathworks https://www.mathworks.com/products/ matlab.html ImageJ Schneider et al.70 https://imagej.nih.gov/ij/ GraphPad Prism 9 GraphPad Software https://www.graphpad.com/ Deposited data Rigidity heatmap algorithm This paper https://github.com/lunweilee/rigidity- heatmap.git Other Dulbecco’s modified Eagle’s medium (DMEM) Sigma‒Aldrich Cat#12800–017 calf serum Thermo Fisher Cat#SH30087.03 Minimum Essential Medium α Thermo Fisher Cat#11900024 fetal bovine serum Thermo Fisher Cat#10437028 polydimethylsiloxane membrane (PDMS) TAIHOYA Corp. Cat#PM22-Collagen type I Fish collagen homemade N/A ATMS dynamic culture system TAIHOYA Corp. Cat#Tansfomer X Cell Reports 44, 115662, May 27, 2025 19 epithelial cell line IEC-18 was generously provided by Dr. Wen-Tai Chiu from National Cheng Kung University in Taiwan and maintained in DMEM supplemented with 5% FBS. .. MDCK cells were pretreated with 10 μM PF573228 (PF228) (Selleckchem, Houston, TX, USA) for 30 min before undergoing cyclic stretch experiments, during which the cells were continuously exposed to 10 μM PF228 for 24 h. Cell contractility was inhibited by treatment with 50 μM blebbistatin (BB) (Tocris Bioscience, Bristol, UK) for 30 min before and during 24 h of cyclic stretching.
Modification:Article Title: Mechanobiological mechanism of cyclic stretch-induced cell columnarization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermo Fisher Cat#H3569 Critical commercial assays xCELLigence E-plates Aglient Cat#300601010 Experimental models: Cell lines Canine: MDCK (NBL-2) cell ATCC CatCCL-34 Canine: MK4 cell HH Lin et al.68 N/A Human: H184B5F5/M10 cell BCRC Cat#60197 Human: IEC-18 cell ATCC Cat#CRL-1589 Human: 293FT cell Thermo Fisher Cat#R70007 Oligonucleotides shRNA target sequence: shTJP1#1 GCAATAAAGCAGCGTTTCTAT RNAi core TRCN0000116252 shRNA target sequence: TJP1#2 CGCCGCATTGTAGAATCAGAT RNAi core TRCN0000091620 siRNA target sequence: siVCL#1 sense CCAACAUUCAGCCACAGAU antisense AUCUGUGGCUGAAUGUUGG This paper N/A siRNA target sequence: siVCL#2 sense CGGAUUAGAACCAACCUCU antisense AGAGGUUCUAAUCCG This paper N/A Recombinant DNA pSVlacOras HH Yeh et al.69 N/A Software and algorithms MATLAB Mathworks https://www.mathworks.com/products/ matlab.html ImageJ Schneider et al.70 https://imagej.nih.gov/ij/ GraphPad Prism 9 GraphPad Software https://www.graphpad.com/ Deposited data Rigidity heatmap algorithm This paper https://github.com/lunweilee/rigidity- heatmap.git Other Dulbecco’s modified Eagle’s medium (DMEM) Sigma‒Aldrich Cat#12800–017 calf serum Thermo Fisher Cat#SH30087.03 Minimum Essential Medium α Thermo Fisher Cat#11900024 fetal bovine serum Thermo Fisher Cat#10437028 polydimethylsiloxane membrane (PDMS) TAIHOYA Corp. Cat#PM22-Collagen type I Fish collagen homemade N/A ATMS dynamic culture system TAIHOYA Corp. Cat#Tansfomer X Cell Reports 44, 115662, May 27, 2025 19 epithelial cell line IEC-18 was generously provided by Dr. Wen-Tai Chiu from National Cheng Kung University in Taiwan and maintained in DMEM supplemented with 5% FBS. .. MDCK cells were pretreated with 10 μM PF573228 (PF228) (Selleckchem, Houston, TX, USA) for 30 min before undergoing cyclic stretch experiments, during which the cells were continuously exposed to 10 μM PF228 for 24 h. Cell contractility was inhibited by treatment with 50 μM blebbistatin (BB) (Tocris Bioscience, Bristol, UK) for 30 min before and during 24 h of cyclic stretching.
Membrane:Article Title: Mechanobiological mechanism of cyclic stretch-induced cell columnarization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermo Fisher Cat#H3569 Critical commercial assays xCELLigence E-plates Aglient Cat#300601010 Experimental models: Cell lines Canine: MDCK (NBL-2) cell ATCC CatCCL-34 Canine: MK4 cell HH Lin et al.68 N/A Human: H184B5F5/M10 cell BCRC Cat#60197 Human: IEC-18 cell ATCC Cat#CRL-1589 Human: 293FT cell Thermo Fisher Cat#R70007 Oligonucleotides shRNA target sequence: shTJP1#1 GCAATAAAGCAGCGTTTCTAT RNAi core TRCN0000116252 shRNA target sequence: TJP1#2 CGCCGCATTGTAGAATCAGAT RNAi core TRCN0000091620 siRNA target sequence: siVCL#1 sense CCAACAUUCAGCCACAGAU antisense AUCUGUGGCUGAAUGUUGG This paper N/A siRNA target sequence: siVCL#2 sense CGGAUUAGAACCAACCUCU antisense AGAGGUUCUAAUCCG This paper N/A Recombinant DNA pSVlacOras HH Yeh et al.69 N/A Software and algorithms MATLAB Mathworks https://www.mathworks.com/products/ matlab.html ImageJ Schneider et al.70 https://imagej.nih.gov/ij/ GraphPad Prism 9 GraphPad Software https://www.graphpad.com/ Deposited data Rigidity heatmap algorithm This paper https://github.com/lunweilee/rigidity- heatmap.git Other Dulbecco’s modified Eagle’s medium (DMEM) Sigma‒Aldrich Cat#12800–017 calf serum Thermo Fisher Cat#SH30087.03 Minimum Essential Medium α Thermo Fisher Cat#11900024 fetal bovine serum Thermo Fisher Cat#10437028 polydimethylsiloxane membrane (PDMS) TAIHOYA Corp. Cat#PM22-Collagen type I Fish collagen homemade N/A ATMS dynamic culture system TAIHOYA Corp. Cat#Tansfomer X Cell Reports 44, 115662, May 27, 2025 19 epithelial cell line IEC-18 was generously provided by Dr. Wen-Tai Chiu from National Cheng Kung University in Taiwan and maintained in DMEM supplemented with 5% FBS. .. MDCK cells were pretreated with 10 μM PF573228 (PF228) (Selleckchem, Houston, TX, USA) for 30 min before undergoing cyclic stretch experiments, during which the cells were continuously exposed to 10 μM PF228 for 24 h. Cell contractility was inhibited by treatment with 50 μM blebbistatin (BB) (Tocris Bioscience, Bristol, UK) for 30 min before and during 24 h of cyclic stretching.
|